Skip to Main Content
Table 2.
PCR primer cocktail to amplify a 631 bp CO1 gene fragment (Ivanova et al., 2007). M13-tails are highlighted.
NamePrimer Sequence
VF2_t1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 
FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 
FR1d_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 
FR1d_t1 CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA 
NamePrimer Sequence
VF2_t1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 
FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 
FR1d_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 
FR1d_t1 CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA 
Close Modal

or Create an Account

Close Modal
Close Modal