Student participation in authentic research, as citizen scientists, can improve classroom engagement, achievement of learning objectives, and perceptions of science. We present DNA barcoding of invasive lionfish (Pterois volitans) prey as an example student citizen-science project, though the protocols, objectives, and outcomes can be generalized to any piscivorous fish. The objective of this five-lab conservation genetics unit is to enhance student understanding of fundamental molecular and ecological concepts through applied use of DNA sequencing technologies. Student assessments were equivocal, indicating modest gains in conceptual understanding and maintenance of an overall high perception of science. More notably, student findings have contributed to an improved understanding of the impacts of invasive lionfish, including providing the first evidence that lionfish prey on economically important red snapper (Lutjanus campechanus).

Introduction

Citizen science represents collaboration between the public and professional researchers to answer important questions in science (Troutmann et al., 2013). When integrated into a classroom setting, citizen science offers potentially transformative opportunities for both students and scientists (Bonney et al., 2009). For partnering scientists, the assistance provided by student volunteers can improve achievement of research objectives and dissemination of research findings. For student citizen scientists, the experience encourages them to identify as scientists by helping to build science skills and science literacy through authentic investigations.

To promote student achievement through increased integration of authentic research into high school and middle school science curricula, we here provide a step-by-step introduction to using DNA barcoding in a classroom setting to investigate the diet of an invasive fish. While we present dietary analysis of the highly invasive lionfish (Pterois volitans) as an example project, the protocols, objectives, and outcomes can be generalized to any species with a mostly piscivorous (fish) diet.

Because of their potential to dramatically alter native species abundance and ecosystem function, invasive predators offer an important target for dietary analysis (Cambray, 2003; Molnar et al., 2008). Characterizing an invasive predator's diet can help predict impacts to food webs, reveal where invasive species occur, and identify potential native competitors. Dietary analysis of invasive predators is also required to determine impacts to essential ecosystem processes, including nutrient cycling and productivity.

More than 75 species of fish have been introduced to marine and freshwater ecosystems of the continental United States (Froese & Pauly, 2018). These include two species of lionfish (P. volitans and P. miles), the popular sportfish brown trout (Salmo trutta), four species of snakehead fish (Channa spp.), and the walking catfish (Clarias batrachus). In addition, many native species with historically restricted ranges have been relocated for sport fishing and are now considered invasive, including largemouth bass (Micropterus salmoides), rainbow trout (Oncorhynchus mykiss), and lake trout (Salvelinus namaycush).

Determining the diet of predatory fishes traditionally requires dissecting and visually examining gut contents (Cortés, 1997); however, these studies often result in ambiguous identifications due to digestion of prey items and the need for prey taxonomic expertise. To overcome these challenges, DNA barcoding is now regularly used in dietary analysis of native and invasive predators (e.g., Côté et al., 2013; Jo et al., 2016). DNA barcoding relies on species-specific mutations within a short, standardized region of the genome to determine the identity of an unknown sample. While no single gene region has been found to resolve all taxa, a ~700 base pair (bp) region of the mitochondrial cytochrome oxidase subunit 1 (CO1) gene can be used to unambiguously identify most animal species (Hebert et al., 2003). The specific advantages of DNA barcoding over traditional taxonomic approaches include identification of degraded or partial samples, identification of morphologically similar species, and reduced need for taxonomic expertise (Hajibabaei et al., 2007).

By integrating DNA barcoding into the classroom, students gain experience with molecular tools and methods currently used in a broad range of research and clinical applications, including forensic science, molecular diagnostic science, environmental monitoring, microbiology, ecology, and evolutionary biology. The five-lab unit guides students through each step in the DNA barcoding process, from fish dissection through DNA sequence cleanup and species identification. In addition to providing practical hands-on training, the DNA barcoding unit provides an engaging opportunity for students to develop their conceptual understanding of fundamental molecular processes and applications, including DNA synthesis, replication, and mutation; enzyme function and temperature dependence; polymerase chain reaction (PCR) methodology and principles; and DNA sequencing technologies and bioinformatics.

Learning Outcomes

The learning outcomes presented here are for DNA barcoding of fish prey. A summary of linked Advanced Placement (AP) and International Baccalaureate (IB) standards is provided in Table 1.

Table 1.
International Baccalaureate and Advanced Placement Biology assessment standards linked to this activity.
ConceptIB TopicAP Essential Knowledge
Origin of cells 1.5 1.D.1, 2.B.3 
Structure and function of enzymes 2.5 4.A.1 
DNA structure 2.6, 3.2, 7.1 3.A.1, 3.A.2, 3.A.3, 4.A.1 
DNA replication 2.7, 7.1 1.B.1, 3.A.1, 4.A.1 
Biotechnology 3.5 3.A.1 
Species, communities, and ecosystems 4.1 2.D.1, 2.D.3, 4.A.5, 4.A.6, 4.B.3, 4.C.4 
Classification of biodiversity 5.3, 5.4 1.B.1, 1.B.2 
ConceptIB TopicAP Essential Knowledge
Origin of cells 1.5 1.D.1, 2.B.3 
Structure and function of enzymes 2.5 4.A.1 
DNA structure 2.6, 3.2, 7.1 3.A.1, 3.A.2, 3.A.3, 4.A.1 
DNA replication 2.7, 7.1 1.B.1, 3.A.1, 4.A.1 
Biotechnology 3.5 3.A.1 
Species, communities, and ecosystems 4.1 2.D.1, 2.D.3, 4.A.5, 4.A.6, 4.B.3, 4.C.4 
Classification of biodiversity 5.3, 5.4 1.B.1, 1.B.2 

Foundational Knowledge Learning Outcomes:

  • Describe DNA structure and the importance of mutation and inheritance in DNA barcoding

  • Explain how DNA data are generated using DNA sequencing, including describing the requirements and results of PCR

  • Describe the process and application of agarose gel electrophoresis

  • Construct a hypothetical food web using student-generated prey data

  • Describe potential ecological and economic impacts of invasive fish species

Application Learning Outcomes:

  • Perform a fish dissection and identify major internal organs

  • Demonstrate an ability to generate DNA sequence data

  • Explain how to locate and extract information from public DNA sequence databases

  • Evaluate and interpret DNA sequence data

  • Identify applications for DNA barcoding in natural resource management and conservation

This project leverages interest in citizen science to guide students through a five-class conservation genetics unit of study, which includes dissection, followed by genomic DNA isolation, CO1 gene cloning (PCR), and DNA sequence analysis to identify dissected prey items.

Conceptualization: Setting the Stage

The objective of the conceptualization stage is to pique student interest in the project and identify prior knowledge through an entry event. Some effective strategies to consider include an article, video, or activity in conjunction with a discussion using predetermined questions. A good entry event is to have students read and discuss one of the many widely available articles highlighting the impact of invasive fish on native ecosystems (e.g., National Geographic's “It all started with a few trout. Now Yellowstone's iconic birds face collapse”). Conceptual questions for the students to consider include

  • Where did the invasive species come from and what was their mode of introduction?

  • What is the species' current invasive distribution and possible means of dispersal?

  • What are documented and hypothesized impacts on native species?

  • Are there potential impacts to fisheries and tourism-related activities?

Instruction: Building Understanding & Skills

The purpose of the instruction phase is to build student knowledge, understanding, and skills through hands-on investigation (Figure 1). Strategies for effective practices include focused instruction on core knowledge, scientific practices, and crosscutting themes; formative assessment of student knowledge understanding and skills; and guided collection of accurate scientific data.

Figure 1.

Student lionfish dissection (top), loading samples for agarose gel electrophoresis (left), and analyzing prey DNA sequences (right).

Figure 1.

Student lionfish dissection (top), loading samples for agarose gel electrophoresis (left), and analyzing prey DNA sequences (right).

Lionfish Prey DNA Barcoding

For the complete instructional unit including step-by-step instructions, student handouts, materials list, and background readings, see https://uwf.edu/ceps/departments/teacher-education-and-educational-leadership/support--resources/TEEL-Projects/PBI-Modules/.

Sources of Lionfish & Alternative Species

When not locally available, whole lionfish and other invasive piscivorous species can be special ordered from fish markets and wholesalers. Always request wild-caught fish. Recommended sources include

  • Pelican Point Seafoods, (727) 934–3134

  • Tropical Soup Cooperation, tropicalsoup1@gmail.com (August–March only)

  • Whole Foods (available throughout Florida; in all other states, contact local store to inquire about special order)

Lionfish are native to the tropical Pacific and Indian oceans. Other commonly available invasive piscivorous species include the following (with native ranges in parentheses):

  • Brown trout, Salmo trutta (Europe and North Africa)

  • Rainbow trout, Oncorhynchus mykiss (North Pacific and associated drainages)

  • Largemouth bass, Micropterus salmoides (Great Lakes, Hudson Bay, and Mississippi river drainages)

  • Lake trout, Salvelinus namaycush (northern Canada south to Great Lakes and New England)

Students working with freshly caught fish had the most success generating CO1 gene sequences from dissected prey items; however, students were able to successfully amplify prey DNA from fish that had been stored frozen for up to two months.

Lesson 1: Dissecting Lionfish

In teams of three or four, students dissected lionfish and collected small tissue samples from dissected fish prey items. During dissection, special care must be taken to limit cross-contamination of prey items and to ensure that prey tissue samples are sufficiently preserved in 95% ethanol until DNA extraction.

Lesson 2: DNA Extraction

Incubation of prey tissue samples at 95°C for 20 minutes in 500 µL of a 5% solution of Chelex 100 Chelating Resin (Bio-Rad Laboratories, Hercules, CA) was used to provide rapid, cost-effective extraction of whole genomic DNA from preserved prey tissue (Walsh et al., 1991). The DNA extraction protocol was designed to be completed by students in a standard 50-minute class; however, the extracted DNA is unstable compared to more time-intensive extraction protocols (e.g., DNeasy Blood and Tissue Kit) and must, therefore, be used within one week to avoid DNA degradation.

Lesson 3: Polymerase Chain Reaction

Following Ivanova et al. (2007), a “universal” PCR cocktail containing four M13-tailed oligonucleotide primers (Table 2; Integrated DNA Technologies, Coralville, IA), MyTaq Red mastermix (Bioline USA, Taunton, MA), and PCR-grade water was used to amplify a 631 bp mitochondrial CO1 gene fragment from dissected lionfish prey.

Table 2.
PCR primer cocktail to amplify a 631 bp CO1 gene fragment (Ivanova et al., 2007). M13-tails are highlighted.
NamePrimer Sequence
VF2_t1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 
FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 
FR1d_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 
FR1d_t1 CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA 
NamePrimer Sequence
VF2_t1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 
FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 
FR1d_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 
FR1d_t1 CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA 

Lesson 4: Agarose Gel Electrophoresis

Students visualized 5 µL of their PCR product on a 1% agarose gel stained with 1X SYBR Green Staining Solution (Lonza Rockland, Rockland, ME).

Preparing Samples for DNA Sequencing

A large number of commercial and academic labs offer DNA sequencing services; however, sample preparation requirements and sequencing cost can vary considerably ($1.90 to $8.00 per sample) depending on the provider, number of samples submitted, and eligibility for academic discounts.

Lesson 5: Prey Identification

Students viewed and edited prey CO1 gene sequences using the free software FinchTV (Geospiza, http://www.geospiza.com). Edited CO1 sequences where identified using the online Barcode of Life Database (BOLD) Identification System (Ratnasingham & Hebert, 2007; http://www.boldsystems.org/index.php/IDS_OpenIdEngine).

Discussion: Explaining & Communicating Information

The objective of the lesson discussion phase is to help students construct evidence-based explanations, improve students' ability to communicate complex information in a clear and effective manner, and empower students to engage in informed decision making. Some effective strategies to consider include discussion or debate, an article summarizing findings to the school newspaper, video presentation of work, letters to government officials, or presentations to the class or a larger student group. The majority of the 44 middle and high school classes undertaking the lionfish unit combined in-class discussion with a final written summary of research findings to encourage students to reflect on, and construct their own understanding of, the experience. To provide a more authentic research experience, students in six classes presented their findings publicly as a research poster, team oral presentation, or individual oral presentation. Presentation venues included school assemblies, regional high school science symposia, and a marine science festival.

Evaluation: Determining Understanding & Skills

The objective of the student evaluation phase is to determine students' conceptual understandings and identify their proficiency with scientific practices. To date, nine teachers involving 911 students from seven schools have participated in the “Invasive Aliens” DNA barcoding project. Students extracted and amplified DNA from 360 lionfish prey. Of these, 60% (217 samples) resulted in high-quality DNA sequences. The remaining samples were either contaminated and unusable (37 samples) or failed to sequence (106 samples). There are a number of reasons why samples might not sequence, including student error, PCR primer mismatch, and DNA degradation. Over the course of the project, we were able to improve student results by sampling only moderately digested prey items and by using freshly collected lionfish; this suggests that prey quality is an important factor in sequencing success.

To measure student content knowledge and perceptions of science, teachers administered a pretest and posttest assessment during the second year of the project. The pretest and posttest content knowledge assessment consisted of 14 multiple-choice questions divided into the following three topics: knowledge of DNA, knowledge of PCR, and knowledge of lionfish. Results of the content knowledge assessment showed modest gains in conceptual understanding (Figure 2). The largest gains were seen in students' understanding of PCR (pre = 37%; post = 46%) and invasive species (pre = 55%; post = 74%). Students' knowledge of DNA prior to participating in the project as determined by the pretest was high (pre = 89%) and remained high (post = 86%) at the conclusion of the project.

Figure 2.

Results of pretest and posttest content knowledge assessment.

Figure 2.

Results of pretest and posttest content knowledge assessment.

A 25-item pre- and post-survey to assess perceptions of science was scored on a five-point Likert scale of “strongly agree,” “agree,” “undecided,” “disagree,” and “strongly disagree.” The items addressed perceptions of the value of science to society, desire to do science, self-confidence in science, anxiety toward science, and perception of science teachers. Data from the Likert-scale perceptions survey were quantitatively analyzed by calculating the aggregate of participants' responses to questions reflective of particular categories with the values for negative questions reversed (Figure 3). The survey revealed that students' view of the value of science to society (pre = 4.3; post = 4.4), desire to do science (pre = 4.0; post = 3.9), self-confidence in science (pre = 4.3; post = 3.9), and perception of science teachers (pre = 4.2; post = 4.0) were high prior to the project and remained high at the conclusion of the project. Similarly, anxiety toward science (pre = 4.3; post = 4.0) was low both before and after the project.

Figure 3.

Results of pre- and post-survey assessment of science perceptions.

Figure 3.

Results of pre- and post-survey assessment of science perceptions.

Conclusion

Together students identified 16 fish species preyed upon by invasive lionfish in the northern Gulf of Mexico (Table 3). Vermilion snapper (Rhomboplites aurorubens) and round scad (Decapterus punctatus) made up the majority of prey items identified by students. The remaining prey species are common on offshore reefs and sand flats, including economically important red snapper (Lutjanus campechanus). Findings from the students' research shed valuable light on the lionfish's generalist diet and highlight the potentially significant threat that lionfish pose to native fish communities through competition and direct predation, and to local economies through impacts to commercial and sport fisheries.

Table 3.
Percent abundance of northern Gulf of Mexico lionfish prey species identified by student DNA barcoding, with family, species, and common name.
TaxonPercent Abundance
Carangidae 27.5% 
Decapterus punctatus (round scad) 24.8% 
Trachurus lathami (rough scad) 2.8% 
Gobiidae 0.5% 
Microgobius carri (Seminole goby) 0.5% 
Labridae 11.9% 
Halichoeres caudalis (painted wrasse) 4.6% 
Xyrichtys novacula (pearly razorfish) 7.3% 
Lutjanidae 34.9% 
Lutjanus campechanus (red snapper) 4.1% 
Pristipomoides aquilonaris (wenchman) 0.5% 
Rhomboplites aurorubens (vermilion snapper) 30.3% 
Paralichthyidae 0.9% 
Syacium papillosum (dusky flounder) 0.9% 
Pomacentridae 2.3% 
 Unknown Chromis 2.3% 
Priacanthidae 0.5% 
Pristigenys alta (short bigeye) 0.5% 
Scorpaneidae 16.5% 
Pterois volitans (red lionfish) 16.5% 
Serranidae 1.8% 
Centropristis ocyurus (bank seabass) 0.9% 
 Unknown Serraniculus 0.9% 
Synodontidae 1.4% 
Synodus poeyi (offshore lizardfish) 1.4% 
Triglidae 0.5% 
 Unknown Triglidae 0.5% 
TaxonPercent Abundance
Carangidae 27.5% 
Decapterus punctatus (round scad) 24.8% 
Trachurus lathami (rough scad) 2.8% 
Gobiidae 0.5% 
Microgobius carri (Seminole goby) 0.5% 
Labridae 11.9% 
Halichoeres caudalis (painted wrasse) 4.6% 
Xyrichtys novacula (pearly razorfish) 7.3% 
Lutjanidae 34.9% 
Lutjanus campechanus (red snapper) 4.1% 
Pristipomoides aquilonaris (wenchman) 0.5% 
Rhomboplites aurorubens (vermilion snapper) 30.3% 
Paralichthyidae 0.9% 
Syacium papillosum (dusky flounder) 0.9% 
Pomacentridae 2.3% 
 Unknown Chromis 2.3% 
Priacanthidae 0.5% 
Pristigenys alta (short bigeye) 0.5% 
Scorpaneidae 16.5% 
Pterois volitans (red lionfish) 16.5% 
Serranidae 1.8% 
Centropristis ocyurus (bank seabass) 0.9% 
 Unknown Serraniculus 0.9% 
Synodontidae 1.4% 
Synodus poeyi (offshore lizardfish) 1.4% 
Triglidae 0.5% 
 Unknown Triglidae 0.5% 

The “Invasive Aliens” project served to motivate students in a real-world citizen science project. Students participating in the project self-identified as scientists and commented on the importance of their contributions to ongoing research. The project highly engaged students in the practices of science and served to enhance their applied science skills. With respect to science knowledge, the modest gains in some conceptual understandings are likely to be the result of teaching the lessons as a stand-alone exercise. More thorough integration of the project into the preexisting units with appropriate introductory and follow-up lessons would likely yield higher gains in science knowledge.

We thank the reviewers for their detailed and constructive comments. We also thank S. Andrews and Bio-Rad Laboratories for support for DNA barcoding teacher workshops; Niuhi Dive Charters for Lionfish donations; and the administrators and staff of Booker T. Washington High School, Escambia High School, Gulf Breeze High School, Navarre High School, Pensacola High School, West Florida High School, and Woodlawn Beach Middle School for facilitating student participation. Special thanks to V. Armand, E. Bauer, A. Cozart, K. Edwards, M. McGregor, M. Meredith, C. Stephens, K. Turner, and S. Walker for their time and dedication to their students. This project was supported by a University of West Florida Pace Academic Development Grant to J.E.

References

References
Bonney, R., Cooper, C.B., Dickinson, J., Kelling, S., Phillips, T., Rosenberg, K.V. & Shirk, J. (
2009
).
Citizen science: a developing tool for expanding science knowledge and scientific literacy
.
BioScience
,
59
,
977
984
.
Cambray, J.A. (
2003
).
Impact on indigenous species biodiversity caused by the globalization of alien recreational freshwater fisheries
.
Hydrobiologia
,
500
,
217
230
.
Carreon-Martinez, L. & Heath, D.D. (
2010
).
Revolution in food web analysis and trophic ecology: diet analysis by DNA and stable isotope analysis
.
Molecular Ecology
,
19
,
25
27
.
Carreon-Martinez, L., Johnson, T.B., Ludsin, S.A. & Heath, D.D. (
2011
).
Utilization of stomach content DNA to determine diet diversity in piscivorous fishes
.
Journal of Fish Biology
,
78
,
1170
1182
.
Cortés, E. (
1997
).
A critical review of methods of studying fish feeding based on analysis of stomach contents: application to elasmobranch fishes
.
Canadian Journal of Fisheries and Aquatic Sciences
,
54
,
726
738
.
Côté, I.M., Green, S.J., Morris Jr, J.A., Akins, J.L. & Steinke, D. (
2013
).
Diet richness of invasive Indo-Pacific lionfish revealed by DNA barcoding
.
Marine Ecology Progress Series
,
472
,
249
256
.
Froese, R. & Pauly, D. (
2018
).
FishBase 2018, version January, 2018
. http://www.fishbase.org.
Hajibabaei, M., Singer, G.A., Herber, P.D. & Hickey, D.A. (
2007
).
DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics
.
Trends in Genetics
,
23
,
167
172
.
Hebert, P.D., Sujeevan, R. & de Waarrd, J.R. (
2003
).
Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species
.
Proceedings of the Royal Society B
,
270
,
S1, S96
S99
.
Ivanova, N.V., Zemlak, T.S., Hanner, R.H. & Hebert, P.D. (
2007
).
Universal primer cocktails for fish DNA barcoding
.
Molecular Ecology Resources
,
7
,
544
548
.
Jo, H., Ventura, M., Vidal, N., Gim, J.S., Buchaca, T., Barmuta, L.A., et al (
2016
).
Discovering hidden biodiversity: the use of complementary monitoring of fish diet based on DNA barcoding in freshwater ecosystems
.
Ecology and Evolution
,
6
,
219
232
.
Molnar, J.L., Gamboa, R.L., Revenga, C. & Spalding, M.D. (
2008
).
Assessing the global threat of invasive species to marine biodiversity
.
Frontiers in Ecology and the Environment
,
6
,
485
492
.
Ratnasingham, S. & Hebert, P.D. (
2007
).
BOLD: The Barcode of Life data system (http://www.barcodinglife.org)
.
Molecular Ecology Notes
,
7
,
355
364
.
Riemann, L., Alfredsson, H., Hansen, M.M., Als, T.D., Nielsen, T.G., Munk, P., et al (
2010
).
Qualitative assessment of the diet of European eel larvae in the Sargasso Sea resolved by DNA barcoding
.
Biology Letters
,
6
,
819
822
.
Troutmann, N.M. (Ed.) (
2013
).
Citizen Science: 15 Lessons That Bring Biology to Life
.
Arlington, VA
:
NSTA Press
. pp.
6
12
.
Walsh, P.S., Metzger, D.A. & Higuchi, R. (
1991
).
Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material
.
BioTechniques
,
10
,
506
513
.