I explain a classroom activity to model translation of RNA into proteins. Students are given worksheets with short mRNA sequences and a genetic code coding phrases instead of amino acids. Students use the code to write a sentence from their mRNA sequences; a "Chuck Norris fact" is provided as an example. I also provide instructions to expand this activity to include transcription of DNA into RNA.

Learning gene expression tends to be difficult for high school and novice college students. Innovative, interactive activities with objects or concepts that students are familiar with have become popular and are effective. Here, I describe an activity in which students translate mRNA codons into sentences analogous to functional proteins. Codons are translated individually into phrases that together become a sentence (in this case "Chuck Norris facts," popular among high school and college students). This project can be repeated with a theme of the teacher's choosing and expanded to include all gene expression (see below).

This activity is intended to supplement the genetics unit of high school science courses and can be completed within a single period at the beginning of that unit. I designed this project to effectively demonstrate translation with minimal prep and takedown time. I completed this activity in less than one class period, and it engaged and entertained my students. It can also be assigned as homework.

Amino acids are replaced by 22 words of the teacher's choosing, each of which match one to four codons, as in the genetic code. In my example, start codons match to "Chuck Norris" rather than methionine, while the three stop codons match "punctuation," which ends the sentence. Each student is randomly assigned one of four premade sequences that consist of a start codon, three to five additional codons in the middle, and one of the three stop codons at the end, and given a codon-word key.

The students have two assignments: (1) Create a string of words (the polypeptide chain) using the mRNA strand given. (2) Form the string of words into a readable sentence (finished protein). The students perform a series of post-translation modifications and turn the string into something functional by adding phrases and modifiers. These modifications can include cutting out a predetermined number of extra words, similar to the cutting of peptides by enzymes. A student's product follows as an example, with bold-face words part of the final product and italicized words cut:

  • mRNA Codons: UGCUUAUCACUAACGAUUGUUGGAGAUGA

  • Translation: Chuck Norris-President-beard-roundhouse kick-destroy-impossible-skeleton-roundhouse kick-vaporize-.

  • Product: "Chuck Norris, the President of roundhouse kicks, can destroy the impossible. He can take on a skeleton, and it will be vaporized by the force of Chuck Norris."

The only common error made by students completing this activity was accidentally shifting reading frames, with missense as the result.

DNA transcription into mRNA can also be incorporated into this activity. Including DNA allows the addition of several important concepts in protein biosynthesis, which are required in high school biology curricula:

  • Promoters – Add additional noncoding letters before the start codon. When the student identifies a sequence associated with a predetermined promoter (e.g., TATA), he or she then starts translation "downstream." Other regulatory elements (e.g., enhancers, silencers) can also be included.

  • Introns and exons – Had students been given "DNA", the letters that they did not include in the final product would be considered introns. Including intron letters demonstrates to students that not all DNA is expressed, an important concept that high school students may not grasp immediately as they learn gene expression.

  • Complementarity and antiparallel strands – The concept of antiparallel, complementary nucleic acid strands with 5' and 3' ends is essential to understanding transfer of genetic information.

  • The sequence from the mRNA sample above is shown as a potential example of a DNA sequence. In this example, the exons are in bold while introns are underlined and the promoter (TATA) is italicized. Note that both template and transcribed sequences read 5'–3':

DNA template sequence: 5'AGTACGTATATCATCTCCAACAATCATGGTCAATGTTAGTGATGTCAAGCAT3'

Pre-mRNA: 5'AUGCUUCAGAUCACUAACAUUGACCAUGAUUGUUGGAGAUGA3'

mRNA: 5'AUGCUUAUCACUAACGAUUGUUGGAGAUGA3'