I present a learning cycle that explores different biotechnologies using the process of in situ hybridization as a platform. Students are presented with a cyclopic lamb and must use biotechnology to discover the mechanism behind the deformity. Through this activity, students learn about signal transduction and discover the processes of polymerase chain reaction, gel electrophoresis, restriction enzyme digests and ligations, cloning, and transformation. Students also discover the nature of scientific inquiry and practice hypothetico-deductive reasoning.

Modern biotechnology techniques are impressive and fascinating as well as diverse in their applications. The challenge for teachers is to demonstrate, in a cohesive way, a wide range of techniques and their practical applications. Most techniques, such as polymerase chain reaction (PCR), restriction enzyme digests, and gel electrophoresis, are taught as isolated techniques with very little focus on their interconnectedness and, more importantly, their practical applications in current research.

The National Research Council (1996) emphasizes the need to teach science as science is done. Following this advice, I present an inquiry-style approach to teaching biotechnology in a way that uses a practical, real-world example that is interesting and bizarre enough to capture students' attention and stimulate their desire to discover. Inquiry teaching, and specifically use of the learning cycle (Karplus et al., 1977; Lawson, 1988; Bybee, 1993), has proved effective in achieving scientific conceptual understanding (Ertepinar & Geban, 1996; Lord, 1997; McGraw, 1999).

This activity explores several biotechnologies, using a cover story and the need to perform in situ hybridization as a platform. The story is about sheep consuming a plant called the corn lily (Californicum veratrum) in the lush hills of northern Austria. This plant contains a chemical, cyclopamine, that interrupts the addition of a cholesterol molecule to the Sonic hedgehog (Shh) signaling protein. This, in turn, interrupts the signal transduction pathway and prevents the division of the brain into two hemispheres (holencephaly). This leads to major facial deformities (including a cyclopic eye) and an unviable fetus (for details, see James, 1999). Students make a hypothesis about the cause of the cyclopia based on other information provided about cyclopamine and Shh. To test their hypothesis, they need to know where in the developing embryo Shh is expressed. In situ hybridization is presented as a method for discovering when and where genes are expressed during development, and it can be applied here using an antisense probe for Shh.

Another challenge for educators is the lack of available equipment and class time to perform most biotechnological processes. This activity is ““virtual”” and does not require any specialized equipment or lengthy incubation times. You may choose to actually perform any of the techniques described (e.g., a real gel electrophoresis) if the equipment or time is available.

Learning Goals & Objectives

The purpose of this lesson is to teach students about modern biotechnology techniques and to give them a sense of real-world applications. Students will discover the following by performing an in situ hybridization:

  • •• Signal transduction pathways and their importance in embryonic development

  • •• The use of PCR in gene amplification

  • •• The use of gel electrophoresis to identify DNA fragments

  • •• The use of ligations and cloning to amplify DNA or even to express protein products

  • •• The existence of bacterial restriction enzymes and their usefulness in differentiating DNA sequences

  • •• The use of in situ hybridization in determining gene expression patterns

Students will practice authentic inquiry by proposing hypotheses and designing experiments to test those hypotheses. Through the use of these biotechnologies, students will use hypothetico-deductive reasoning to interpret results and form appropriate conclusions. Students will also be introduced to various other practical applications of these techniques and questioned about the ethical dilemmas of modern biotechnology.

I have used this activity for beginning college freshmen in an introductory biology course. The activity takes approximately 2.5 hours to complete. It can be modified to fit your students' needs and the available time. It is assumed that students have already learned about basic cellular anatomy, DNA and its purpose, and mechanisms of gene expression.

Background

In early embryonic development, Shh initiates the division of the brain into hemispheres. For Shh to function properly, a cholesterol molecule must be covalently bonded to its C-terminus (for details, see Maity et al., 2005). Mutations in Shh or inhibitions of cholesterol synthesis lead to holoprosencephaly (the condition characterized by a lack of division of the forebrain into right and left hemispheres). If pregnant ewes consume corn lilies on the 14th day of gestation, lambs are born cyclopic the following spring (for details on teratological research on lambs, see James, 1999). The mechanism whereby cyclopamine in corn lilies inhibits the attachment of cholesterol to Shh is still largely unknown (Incardona et al., 2000). A similar defect is found in humans and results in Smith-Lemli-Opitz syndrome (see Roux et al., 2000). Shh is expressed down the midline of the developing embryo, orchestrating the division into right and left sides.

Basic descriptions of PCR, gel electrophoresis, restriction enzyme digests and ligations, cloning, and transformation can be found in any introductory biology text. I recommend Campbell and Reece (2008).

Introductory Activity

Students work in pairs on this activity. Each pair will need the following:

  • ••A paper plasmid, cut and taped together (see  Appendix 1)

  • ••A strip of Shh DNA (this, of course, is an abbreviated version of the true gene, containing only a single exon; see  Appendix 1)

  • ••Tape and scissors

If you choose to demonstrate an actual technique, supplies will need to be provided accordingly.

For images to enhance learning or capture students' attention, go to the following Web sites:

Learning Cycle

Exploration and explanation are done simultaneously in this activity. The activity can be shortened to fit within about 1 hour and 15 minutes by omitting steps 5 through 9 and offering a brief introduction to the rest of the activity (this introduction is provided before step 10 below).

1.

Present the students with a picture of a cyclopic lamb and tell them that the lamb's mother consumed a plant called the corn lily during the winter, when food was scarce. Tell them that analyses have indicated that a poisonous substance in the plant, cyclopamine, can apparently cause cyclopia. Provide the following background information (from published studies) and ask them to come up with hypotheses to explain what is happening to the lambs.

  • •• Inhibiting cholesterol synthesis in experimental animals causes a birth defect called holoprosencephaly (HPE), in which the brain does not split into two hemispheres, which results in a single eye and single nose above the eye.

  • •• A similar defect occurs in humans, though rarely. Termed Smith-Lemli-Opitz syndrome, it is caused by a defect in a cholesterol-synthesizing enzyme. In severe cases, the affected fetus is cyclopic.

  • •• Shh is expressed at the time when left and right sides are established during development (keep in mind that it is one of many proteins expressed at this time).

  • •• Shh requires a cholesterol to be added to it after it has been translated in order to signal properly (keep in mind that Shh is one of many proteins that require the addition of a cholesterol).

2.

Have students share their hypotheses about Shh signaling with the class. Discuss evidence that supports their hypotheses. (Allow partnerships to share their ideas, but keep the discussion to around 5––10 minutes.)

3.

Discuss the process of signal transduction. Explain that cells communicate with each other about their respective positions and functions in order for development to occur properly. This communication is accomplished through protein messengers that are produced by one cell and signal another cell. The receiving cell interprets the message through the use of a signal transduction pathway that initiates the expression of new proteins. Once this has been explained, allow students a moment to label Figure 1. Have them mark, on the figure, where they hypothesized that the signal is being interrupted by cyclopamine.

Figure 1.

Sonic hedgehog signaling. Key: 1. e, 2. f, 3. b, 4. c, 5. d, 6. a, 7. g, 8. h.

Figure 1.

Sonic hedgehog signaling. Key: 1. e, 2. f, 3. b, 4. c, 5. d, 6. a, 7. g, 8. h.

4.

Explain to students that in order to test our hypothesis that cyclopamine is inhibiting Shh signaling and that this in turn is causing cyclopia, we need to check the expression pattern of Shh to see if it is expressed in the right place and at the right time during development. Ask the following question and have the students discuss it with their partners and come up with an experimental design: How can we visualize the expression of a given gene in an embryo? (Allow students 10––15 minutes; you may want to walk around and direct their discussions with the following questions: If a gene is being expressed, what products might we find that are specific to that gene? How are we going to see these products?) It is not expected that students will be able to come up with the detailed procedures, but they should be able to suggest that we look for either the mRNA of the gene or the protein product itself.

5.

Hopefully, at least one partnership came up with the idea to look for the mRNA of the Shh gene. Explain that we are going to develop a probe that recognizes (““hybridizes with””) the Shh mRNA. Tell the students that in order to make a probe, we need to isolate and make copies of the Shh gene. Ask the following questions:

  • •• How many copies of the Shh gene does a typical cell have? (Students should be able to come up with the answer two –– one from the mother and one from the father.)

  • •• Where might you find a source of DNA? (Sources of DNA can include any cells from the body of a sheep.)

  • •• When making our probe, should we use the entire gene sequence, just introns, or just exons? (Make sure that the students understand that the Shh mRNA contains only exons. Therefore, our probe must be produced using a cDNA library, or, as is done in this activity, produced using a single exon from the gene.)

6.

Remind the students of the process of semiconservative DNA replication. (Briefly, during normal DNA replication, the double helix is denatured by the enzyme helicase. The enzyme primase constructs primers by complimentary base-pairing with the single-stranded DNA. DNA polymerase then recognizes the primers and continues to elongate the DNA until a complete complementary strand is made. The process results in two identical double-stranded DNA molecules.) Tell the students that we want to perform this process in a test tube. Ask the students to come up with a list, working with their partners, of items that must be added to the test tube in order to perform DNA replication. (Students' lists should include original DNA, helicase, primase, DNA polymerase, and nucleotides for building new DNA.)

7.

Once students have shared their lists, compare each item listed with what is actually used in the process of PCR (see Table 1).

Table 1.

A comparison of cellular components used for semiconservative DNA replication and the methodology of polymerase chain reaction.

The cell uses……Polymerase chain reaction uses……
Original DNA Original DNA 
Helicase Heat: by heating DNA, we can denature the double-stranded helix. 
Primase Gene-specific primers: because we do not want the entire DNA strand replicated, we add premade primers specific to the single exon in our gene sequence rather than adding the primase enzyme. 
DNA polymerase Special DNA polymerase: during the PCR reaction, the temperature must be raised above what is tolerable for a normal mammalian enzyme, so a special heat-resistant DNA polymerase enzyme must be used. 
Nucleotides Nucleotides 
The cell uses……Polymerase chain reaction uses……
Original DNA Original DNA 
Helicase Heat: by heating DNA, we can denature the double-stranded helix. 
Primase Gene-specific primers: because we do not want the entire DNA strand replicated, we add premade primers specific to the single exon in our gene sequence rather than adding the primase enzyme. 
DNA polymerase Special DNA polymerase: during the PCR reaction, the temperature must be raised above what is tolerable for a normal mammalian enzyme, so a special heat-resistant DNA polymerase enzyme must be used. 
Nucleotides Nucleotides 

8.

Explain that once PCR has run, we need a way to visualize what we have done. In other words, we need to make sure that our reaction worked and that we amplified the right piece of DNA. If it worked, we should end up with hundreds of pieces of DNA that are the length of the Shh exon (which is 66 base pairs [bp]). Give students the set-up shown in Figure 2 and ask them to think of a way that they could use this set-up to visualize their DNA fragment. Give them the following information about gel electrophoresis:

  • •• The agarose gel is composed of a protein-rich matrix. It is the consistency of Jell-O Jigglers. DNA must make its way through the matrix. The shorter the piece of DNA, the faster it will be able to move through the matrix.

  • •• DNA is negatively charged and will travel toward the positive electrode when an electrical current exists.

  • •• The buffer solution is a salt solution that increases conductivity.

Figure 2.

Gel electrophoresis apparatus.

Figure 2.

Gel electrophoresis apparatus.

Give the students time to discuss this with their partners. Then have them share their hypotheses with the class. Use these hypotheses to elucidate the process of gel electrophoresis. Once the process has been explained, you may choose to have the students set up and run a gel. While the gel is running, move on with the activity, but DON'T FORGET TO WATCH THE GEL! (Supply kits for gel electrophoresis can be found through any biological supply company.)

9.

At this point, you may want to have a discussion about practical applications of gel electrophoresis. This may include a discussion about RFLPs, DNA fingerprinting, body identification for forensics, and so on.

(An introduction to be used if omitting steps 5––9: Hopefully, at least one partnership came up with the idea to look for the mRNA of the Shh gene. Explain that we are going to develop a probe that recognizes [““hybridizes with””] the Shh mRNA. Following are the procedures for making an in situ hybridization probe.)

10.

Explain that once we have amplified the right gene (or obtained it from an outside source), we need it in a form that allows us to build a probe that will recognize its mRNA. To do this, we will be using bacterial plasmids. Explain that plasmids are naturally occurring, self-replicating, extragenomic DNA in bacteria. Scientists are able to artificially generate plasmids with desired traits, such as antibiotic resistance and RNA polymerase promoter sites. Scientists can also insert desired pieces of DNA (like the Shh gene) into plasmids and place them in bacterial cells. This is called DNA cloning. Bacteria replicate (by asexual reproduction) about every 20 minutes, thus replicating the plasmids within. Discuss other practical applications of plasmids such as to produce insulin or for gene therapy.

11.

Give the students a copy of Figure 3, which depicts a specialized plasmid. Point out the following key features:

  • •• Overhanging thymine residues on each end. Explain that PCR results in DNA pieces with overhanging adenine residues on each end, as shown in Figure 3. (Note: if you omitted steps 5––9 you may choose to discuss the concept of PCR at this time, but it is not necessary.)

  • •• SP6 and T7 RNA polymerase promoter sites. These allow scientists to transcribe the DNA that has been inserted into the plasmid.

  • •• Ampicillin resistance gene (Ampr). This allows us to select only bacteria that contain our specialized plasmid. By growing bacteria on agar plates containing Ampicillin, we can eliminate bacteria that did not receive a plasmid. (This concept will be discussed below. However, you may choose to omit a detailed discussion of transformation and selection of bacterial colonies in the interest of time.)

Figure 3.

A specialized plasmid to be used for DNA cloning. The numbers mark the length of the plasmid in base pairs (i.e., the plasmid is 3600 base pairs long with an Ampr gene at approximately base pair 1600).

Figure 3.

A specialized plasmid to be used for DNA cloning. The numbers mark the length of the plasmid in base pairs (i.e., the plasmid is 3600 base pairs long with an Ampr gene at approximately base pair 1600).

12.

Have the students draw a proposed mechanism for how we can insert our DNA piece produced through PCR into the plasmid. Give them a copy of the paper plasmid and have them simulate the cloning procedure by taping it into the plasmid. (The finished product should be a circle with the Shh DNA taped in between base pair 1 and base pair 3600 of the plasmid, as shown in Figure 3.)

13.

(Optional) Once the students have taped their DNA fragment into their plasmids, introduce the terms ““ligation”” and ““transformation”” and explain why we grow the bacteria on ampicillin plates and how we isolate the DNA. (To transform bacteria, the ligated plasmid is forced into bacterial cells using high salt concentrations or electrical current. However, not all of the bacterial cells will get a plasmid. We grow them on ampicillin plates to select only bacteria that have been transformed, since bacteria that did not receive a plasmid will not be resistant to ampicillin. DNA is collected through bacterial lysis and ethanol precipitation.)

14.

Have the students compare their cloned plasmid to that of a neighbor. They should have noticed that at least one of their neighbors taped the DNA fragment into the plasmid in the opposite orientation from theirs. Point out that there are two ways for the ligation to occur and that they occur with 50%% probability (the gene could have been taped in with the start codon [ATG] adjacent to the T7 side of the plasmid or adjacent to the SP6 side of the plasmid).

15.

Explain that we are going to use this clone to make a probe that will recognize the Shh mRNA that is in the embryonic cells. Ask the students whether the probe should be the same sequence as the mRNA or the complement of the mRNA. Once this has been discussed among the students, tell them that the probe must be antisense in order for it to hybridize with the mRNA. Discuss the presence of a T7 polymerase and an SP6 polymerase promoter site on opposite ends of the plasmid. One of these polymerases will make a sense probe (one identical to the mRNA), and one will make an antisense probe (the complement to the mRNA). Ask the students how to figure out the orientation of the DNA fragment and how to decide which polymerase to use. (Allow them to think about this for a moment. However, they might not be able to come up with a suitable answer at this point.)

Discuss the synthesis of a probe and how a marker must be added in order for the probe to be visually identified. A common method is to attach a label to the nucleotides used in making the probe. These labels can be identified by using antibodies with attached colored or fluorescent dyes.

16.

Explain that, realistically, we cannot see the actual orientation of our piece. (In other words, we don't know whether to use the T7 polymerase or the Sp6 polymerase to make our antisense probe.) But we can use a test to determine the orientation. We will use restriction enzymes to make restriction fragments. This will reveal the orientation. There are many different restriction enzymes and each cuts a very specific, palindromic (e.g., RACECAR backwards is still RACECAR) sequence. The EcoRI restriction site is the sequence G^AATTC. The carrot (^) indicates where the restriction enzyme cuts the DNA. Make sure that the students notice that the sequence is palindromic.

17.

Give the students the following piece of DNA and ask them what fragments would result if we cut it with EcoRI:

……AAGTCTGATCCTAGAATTCGATCTACCTGATCAGTCTGGACTTCATG……

……TTCAGACTAGGATCTTAAGCTAGATGGACTAGTCAGACCTGAAGTAC……

(Key: 14 bp and 33 bp if counting the top strand; 18 bp and 29 bp if counting the bottom strand.)

18.

Tell students that the Shh gene has a SacII restriction site at base pair #19 (SacII is another restriction enzyme). Our specialized plasmid also has a SacII restriction site at base pair #40. The SacII cut sight is CCGC^GG. Ask students how they can use the SacII restriction enzyme to determine the orientation of the Shh DNA in the plasmid. (Hint: Try cutting your plasmid and DNA insert at the SacII restriction sites and comparing your resulting fragments to your neighbor's.)

Give the students at least 10 minutes to struggle with this and to come up with a workable hypothesis. (It is important to allow them time to reason through this process.) Have them share their hypotheses with the class, and then use these hypotheses to explain how it is done. Demonstrate cutting the plasmid and the DNA fragment in each of the orientations. If the DNA strip was taped in with its start codon adjacent to the SP6 side of the plasmid, the fragments should be 59 bp and 3607 bp. If the DNA strip was taped in with its start codon adjacent to the T7 side of the plasmid, the fragments should be 87 bp and 3579 bp. Draw a giant gel on the board and run two groups' cut plasmids on the gel showing that the 59-bp piece would be lower than the 87-bp piece and the 3607-bp piece would be higher than the 3579-bp piece. In this way, we should be able to correctly identify in which orientation our DNA fragment ligated. A sample gel is shown in Figure 4. The well on the left contains the 87-bp and 3579-bp fragments; the well on the right contains the 59-bp and 3607-bp fragments.

Figure 4.

Sample gel electrophoresis results.

Figure 4.

Sample gel electrophoresis results.

19.

Now that we have determined the orientation of our gene, an antisense probe can be made and gene expression patterns can be determined. Explain the importance of determining gene expression patterns. Gene expression patterns serve as observations on which to base hypotheses for testing the function of these developmental genes. Only if a gene has the correct spatiotemporal expression pattern can it be considered as a candidate for a given developmental function (e.g., dividing the brain into hemispheres).

20.

Show students a picture of a Shh in situ and ask them if it is a good candidate for dividing the brain into hemispheres. Shh in situ photographs can be obtained from GEISHA at the University of Arizona at http://geisha.arizona.edu/geisha/search.jsp?gene=2929 (see Hurtado [2006], figures E and F to see that it is expressed down the entire length of the CNS, specifically on the ventral surface in the center; also see Zhang [2001], figure B.) Point out that Shh is indeed expressed in the right region to be responsible for dividing the hemispheres.

21.

As a final and optional exercise, ask the students to design an experiment that manipulates Shh expression (either by removing it or by over-expressing it) that would give support to our hypothesis that Shh signaling is being disrupted in the cyclopic lamb. (Remind students that seeing the expression pattern of Shh does not confirm its role in the hypothesized function. That is why it is necessary to run further experiments like manipulating Shh expression.) Allow them time to share their experiments with the class and discuss the plausibility of each. You may choose to discuss the following technologies:

  • •• siRNA inhibition: a method whereby small pieces of double-stranded RNA are introduced that trigger the degradation of the homologous mRNA through RNA interference.

  • •• Electroporation: a method that uses electrical current to force pieces of DNA or RNA into cells in a living embryo.

  • •• Knock-out mice: mice genetically bred to have a defect in one or both copies of a given gene.

  • •• Viral transduction for over-expression: viruses can be used to introduce genes into cells. Because viruses program the cell to express the DNA they insert, a target sequence will be expressed by the infected cell.

22.

Finish with a discussion of practical applications of these technologies. You may choose to include some of the following:

  • •• Diagnosing disease by gene markers

  • •• Gene therapy

  • •• Pharmaceutical products (human insulin, human growth hormone, blood thinners, HIV inhibitors, vaccines)

  • •• Forensic evidence

  • •• Environmental clean-up

  • •• Transgenic farm animals and plants

Many of these topics can prompt a discussion on the ethical issues involved in biotechnology.

Recommendations & Conclusions

The learning cycle outlined here engages students with a puzzling phenomenon –– the birth of cyclopic lambs. Students explore many different biotechnologies and hypothesize ways in which they might use such techniques to help explain the phenomenon. In the process, they learn various applications of biotechnology. It is recommended that students later be given the opportunity to elaborate on their newly developed concepts by applying these techniques to a novel situation. Chances for evaluation of student learning are abundant in the sample elaboration activity presented in  Appendix 2.

I hope that this activity will give your students not only an understanding of biotechnology techniques, but also an appreciation and deeper understanding of the nature of scientific inquiry. We must teach students how to learn, so that they leave our classrooms equipped with the tools necessary to become truly educated.

Acknowledgments

Thanks to Dr. Michael Stark and Dr. John Kauwe for review of the manuscript. I am also deeply indebted to Dr. Anton Lawson for teaching me the art of inquiry.

References

References
Bybee
R.
(
1993
).
An Instructional Model for Science Education. Developing biological literacy
.
Colorado Springs, CO
:
Biological Sciences Curriculum Studies
.
Campbell
N.A.
Reece
J.B.
(
2008
).
Biology, 8th Ed.
San Francisco
:
Benjamin Cummings
.
Ertepinar
H.
Geban
O.
(
1996
).
Effect of instruction supplied with the investigative-oriented laboratory approach on achievement in a science course
.
Educational Research
,
38
,
333
––
341
.
Incardona
J.P.
Gaffield
W.
Lange
Y.
Cooney
A.
Pentchev
P.G.
Liu
S.
& others
. (
2000
).
Cyclopamine inhibition of Sonic hedgehog signal transduction is not mediated through effects on cholesterol transport
.
Developmental Biology
,
224
,
440
––
452
.
James
L.F.
(
1999
).
Teratological research at the USDA-ARS poisonous plant research laboratory
.
Journal of Natural Toxins
,
8
,
63
––
80
.
Karplus
R.
Lawson
A.E.
Wollman
W.
Appel
M.
Bernoff
R.
Howe
A.
& others
. (
1977
).
Science Teaching and the Development of Reasoning: A Workshop
.
Berkeley
:
University of California Press
.
Lawson
A.E.
(
1988
).
A better way to teach biology
.
American Biology Teacher
,
50
,
266
––
289
.
Lord
T.R.
(
1997
).
A comparison between traditional and constructivist teaching in college biology
.
Innovative Higher Education
,
21
,
197
––
216
.
Maity
T.
Fuse
N.
Beachy
P.A.
(
2005
).
Molecular mechanisms of Sonic hedgehog mutant effects in holoprosencephaly
.
Proceedings of the National Academy of Sciences
,
102
,
17026
––
17031
.
McGraw
C.
(
1999
).
Teaching science cooperatively in middle/high school
.
Education Digest
,
64
,
29
––
33
.
National Research Council
. (
1996
).
National Science Education Standards
.
Washington, DC
:
National Academy Press
.
Roux
C.
Wolf
C.
Mulliez
N.
Gaoua
W.
Cormier
V.
Chevy
F.
Citadelle
D.
(
2000
).
Role of cholesterol in embryonic development
.
American Journal of Clinical Nutrition
,
71
,
1270S
––
1279S
.
Appendix 2.

Sample Elaboration Activity

Appendix 2.

Sample Elaboration Activity